El comienzo del Camino


-13, Rue du Port Vieux. S’il vous plaît. Y justo tres minutos más tarde me subo a ese coche con la mochila. La mujer que lo conduce me recuerda a Brigitte Fontaine y quiere saber con su misma voz la dirección a la que nos dirigimos. Luego dice que llegaremos justo dentro de dieciocho minutos, que compruebe mi reloj y que si son más me regala la carrera por ser un peregrino. Mientras, giramos por el oeste hacia Place du Port Vieux, y después hacia la derecha por Perspective de la Côte des Basques, y en la rotonda tomamos la segunda salida en dirección a Avenue de Londres y giramos a la derecha, hacia Rue Jean Jaurès, y en la rotonda tomamos la segunda salida en dirección a Avenue de la Gare, y giramos a la derecha hacia Rue Guy Petit y, ahí, me pregunta que si me apetece escuchar algo de música, y yo le digo que eso estaría bien. Y, a continuación, ella que si tengo alguna preferencia, y en la rotonda la primera salida en dirección Porte de Biarritz y yo le digo que Brigitte Fontaine me gusta, y continuamos por Voie de Maysonnabe y ella no vuelve a decir ninguna otra palabra, y escuchamos ‘Crazy Horse’ y nos dirigimos por Bretelle Sabaon, y en la rotonda tomamos la segunda salida en dirección al Boulevard du Bab, y en la rotonda la primera salida en dirección a Avenue Maréchal de Lattre de Tassigny y, entonces, escuchamos otra vez ‘Crazy Horse’ y otra vez ‘Crazy Horse’, mientras giramos ligeramente hacia la derecha ,hacia Avenue de Biarritz, y ligeramente hacia Avenue d’Espagne, y en la rotonda tomamos la segunda salida en dirección a Avenue de Pampelune y giramos hacia la Rue d’Espagne, y continuamos por Place Pasteur y ahí le pago. Pero la catedral ella dice que no abre sus puertas hasta las diez y soy católico; uno que, hace algunas semanas, le escuchó decir a una alumna suya algo que quisiera no haber oído, porque le dolió: <<¿Cómo saber que una persona es católica? Porque odia, odia, odia pero dice que no odia.>>

Ando por la rue d’Espagne y giro en la rue de la Poissonnerie y hasta que me detengo frente al escaparate de una librería, en la que respira la ingenua caligrafía con la que su dueño ilustra las sinopsis de la última novela negra que se pone a la venta en Francia.

Consumidor insomne de palabras, lo voy leyendo todo, aunque sólo hasta que reconozco la firma de Ledun, el autor de los éxitos del supense ‘Fractal’ y ‘Marketing Viral’. Pero esa doble línea que compara la matriz de las mujeres con las estrellas y las estrellas muertas me estremece.

Doy dos pasos atrás y me concentro en cada año de vida que he vivido a través de las obras que ya no se reseñan. Garat, Bello, Sansal en el 2008 y tarde, Rufin, Darrieussecq, Makine…. Maalouf, 1988 y con Samarcande, Japrisot, Le Clézio 1985 y 1984 el año de la Archéologie du Zéro de Nadaud y yo, que en 1983, el instante de Jacques Lacarriere, tengo tan sólo 19 años pero que, sin embargo, ya he dejado pasar de largo la primera ocasión de haber sido terriblemente feliz.

A Nathalie Sarraute no la he leído pero ahí dice que en el año anterior publicó esa pequeña pieza de teatro, y donde el lenguaje se convierte en la opresión de un torniquete, y más que lo que se dice… lo que importa es lo que no se dice.

Son las nueve y media y la puerta de La Rue en Pente se abre al público. Calculo hacerme con otra guía que se extienda algo más que la que me agencié hace un par de días en Biarritz. Gérard, que así se llama el librero, insiste en que con una sola guía para realizar el Camino a Compostela es más que suficiente, que no me cargue con exceso de equipaje, así que le agradezco el consejo y le tiendo sólo unos francos por ese título de Sarraute, ‘Pour un oui ou pour un non’.

Pero en el interior de Sainte-Marie todo lo que hago es seguir el hábito pálido de esa religiosa que se apoya en un báculo y camina unos pasos por delante de mí, también con una mochila pendiendo de la espalda. Y cuando, siguiendo todavía sus pasos, cruzo el puente sobre el Adur, lo que veo, sobre el cuerpo de cada una de sus farolas, es el anuncio del león blanco y los blancos tigres de ojos azules de un circo. Los mismos que me recibían en Biarritz, igualmente a la salida de la Gare, como ahora que me dirijo hacia ella, preguntándome si esta mujer, que viste de hábito, habrá oído hablar de esa teoría en la que cierto tipo de sistemas muy dinámicos, los sistemas más inestables, se comportan muy sensiblemente con respecto a las variaciones de las condiciones iniciales.

Pocos metros de distancia eran los que nos separaban en la Place Pereire pero al penetrar en el interior de la Estación, un edificio monumental que recuerda al de la Place Louis-Armand en el distrito XII de París, ella parecía haberse desvanecido en el aire, hecho -lo confieso- que me desorientó.

<<Siendo físicas –dicen los científicos- las ondas electromagnéticas pueden prescindir de un medio por el cual propagarse, siendo, en realidad, dos campos que se generan mutuamente y, por tanto, que no precisan acciones a distancia. La sustantividad es lo estante y la inteligencia intelige lo estante.>>

No termino de pensar la vida en la moneda de la Comunidad y la pienso como me acostumbré a atesorarla, muy metódico y hasta puede decirse que interesado, en el puño de la infancia. Pero este anacronismo nadie lo sospecha siquiera, y casi diez euros al cambio son cerca de sesenta y cinco francos, y cuando la personalidad del viajero está a punto de perturbarse.

El Ter que debo de tomar para alcanzar el pueblecito de Saint-Jean-Pied-de-Port, al pie de los Pirineos y a escasos kilómetros de la frontera con España, parte del andén número seis al otro lado de las vías; y que será desde donde vea o me imagine, por última vez, su hábito, puesto que no voy a tener esa suerte; y si la hermana-lirio se dirige al Camino… busca comenzarlo desde otra localidad; tal vez en el Puente de Santiago sobre el Bidasoa, otro de sus inicios míticos si hay que hacer algún caso de lo que se lee en las guías. Pero esta otra mujer, la que pierde su mirada en la distancia y ocupa este mismo banco ajena a mí… podría ser una buena sustituta.

I’m sorry to bother you but…

– Excuse me but I don’t speak english -me detiene seria.

Parlez-vous français?

Non, je ne parle pas français mais j’aime la langue française

Carmen era española, y yo me río con esa alegría que adora la directora de la escuela. <<Bon>>. Yo soy profesor de español. Y que, ¿cómo me llamo? <<¡Ah! Hervé>> . Pero su mirada permanece inquisitiva sobre mí, como si esperara algún tipo de presentación más formal, y le digo el primer apellido que se me ocurre, el apellido de la editorial de la obrita de Sarraute, Gallimard. Hervé Gallimard y también que vivo y trabajo en Le Havre, lo cual, hasta hace algunos días, era cierto. Y a traducir me ha puesto al artista Bobo, Bertrand Belin, lo cual me ha parecido una coincidencia asombrosa, por el título, precisamente, de la canción que ahora estamos escuchando: ‘Pour un oui, pour un non’. Pero lo hago encantado porque ella sonríe bonito, y en seguida nos hemos subido al tren, porque hemos comprobado que otros que llegaban ni siquiera se detenían en el andén y ya se sentaban dentro; y aunque era casi media hora la que aún faltaba para que nos pusiéramos en marcha. Pero la magia es así. De repente sentirse muy cómodo con alguien que hasta ese mismo instante no se conoce de nada, cuando la casualidad te empuja objetivamente a ello. La magia o el amor o el dios de las palabras.

Pero con Carmen no resultó como con Albany. Albany, que era tan inexperta entonces, que hasta el más mínimo artificio -como ese de Leibniz y el destino y la cadena áurea- era asaz para deslumbrarla. Pero con Carmen no, porque Carmen recordaba las lecciones de su paisano, el pensador Ortega, cuando aquel día les pidió que tomaran de entre sus convicciones una de las que más firmes parecían: que dos y dos son cuatro, y que era algo, eso, que les constaba a todos, aunque suponiendo que si se detenían a analizar esa constancia se iban a encontrar con algo sorprendente; es decir, con el hecho probable de que ninguno de ellos se hubiera hecho nunca cuestión de si dos y dos son cuatro. Así que, entonces, ¿qué quería decir ese que les constaba, que tenían esa convicción? Y lo que quería decir era que la habían recibido de su contorno social, que habían oído eso pero que lo que a ellos en la práctica les constaba era sólo que a otros les consta eso, por ejemplo, a los matemáticos <<o expresado con el otro término, tienen ustedes la convicción de que otros tienen esa convicción; pero eso quiere decir que de esta convicción no están ustedes convencidos. Usan de ella pero no es suya -hacen ustedes como si les constase. Por lo que, en definitiva, esa es una constancia sin efectividad, una constancia ficticia, que está en uno porque está en otros, porque nos la encontramos en el contorno social.>>

Y como había sido yo, el que esta tentativa con la filosofía la había comenzado, no me quedaba otro remedio que dejarla concluir, y sin pestañear siquiera, ese ”razonamiento vital”. Y la cosa seguía, más o menos, así: la orientación ficticia no presupone desorientación previa. Y el individuo (o la persona a la que ella se refería) sólo podía ubicarse en una de dos situaciones: una auténtica, que implica la desorientación y, por lo mismo, nos obliga a orientarnos; y otra ficticia, falsa, en que nos damos por orientados. Y si el individuo o la persona <<conduce sus actos, esto es, va viviendo en vista de su orientación, del repertorio de sus convicciones, en el caso de la orientación ficticia todos sus actos, por tanto, su vida toda será ficticia.>> Y ahí es cuando me tengo que quitar el sombrero, porque esto no le sucede a uno todos los días, el que se descubra desesperado por oír ese diagnóstico de lo que lo abate, y alguien, al que se acaba de disuadir de su mutismo, empiece a decírselo así, en modo tan a las claras, como si lo estuviera leyendo en su propio interior, que ese presentimiento, el darse cuenta uno de que ha adoptado desde siempre esa orientación ficticia, sólo por no hacerse cuestión de las cosas, supone, ahora, el experimentarse abrumadoramente perdido, perdido por un instante infinito. Y a punto de concluir con palabras letales <<lo cual equivale, si fuese cierto este análisis que ahora sólo se insinúa… que huyen ustedes de su auténtico ”si mismo” y lo sustituyen por una personalidad convencional.>>

Conjugo el verbo amar. Te lo prometo. 3 – 2 yo no sé ya si son uno. Albany, cráter de Marte, apenas se tenía de pie. ¿Y tú a qué te dedicas? ¿Eres profesora en alguna facultad de letras? ¡Ah, escritora. Qué interesante eso! ¿Y has estado antes en el Camino?


Carmen había comenzado su andadura dando un salto a medio trayecto, en parte por un individuo que la merodeaba y, en parte, por otro peregrino al que había conocido en las etapas navarras… para terminar por regresar, luego, después de bañarse en el océano, al mismo lugar donde diera el salto, finalizando justo esa andadura en el centro mismo del Camino, como si regresara al centro de si misma. Pero Carmen no era quien iba a sacarme de dudas acerca de lo que yo perseguía saber, si lo que se lee es cierto y si las etapas de la meseta castellana son tan cruciales para el alma como algunos cuentan; o si el espíritu al atravesar Galicia se siente renovado. Aunque, si Carmen no iba a sacarme de dudas, sólo afirmó que era porque todo depende de nosotros y de quiénes somos nosotros realmente y de lo que vamos en busca. Pero, entonces, ¿no se viene al Camino -le pregunto- a aceptarnos los unos a los otros? ¡Ah, que yo no soy mujer y nunca podré adoptar el punto de vista de una mujer! ¿Y cómo sois las mujeres? ¿Y cómo se supone que somos la mayoría de los hombres? ¿Genéricos? ¿qué quieres decir con eso?

 

Yo soy de los que piensa que las personas que quieren abortar lo que no quieren es tener un vínculo. El hijo produce una unión y Albany sabía como pensaba yo pero hay quien opina que, intrínsecamente, es mentira que uno quiere encontrar al otro, porque el otro es un ser humano distinto a uno; y todo, hoy en día, tiene que ser similar, lo igual o lo semejante. Y lo que Carmen dice es que las mujeres como ella acaban por ser selectivas, y que a medida que el tiempo transcurre, la conformidad con las cosas es menos. Pero también que la <<escogencia>> -como dirá Sartre- depende del niño que se fue, y que morir no basta, que hay que morir a tiempo.

Ella, yo -dice- cuando lo emprendí, mucho antes, buscaba la muerte psicológica, ¿y tú? -me preguntó- ¿Es eso lo que buscas? Pero la respuesta habría de demorarse. Buscar, buscar no sé si busco algo -digo. Ahora sólo me estoy dejando llevar. Y es ahí cuando ella sostiene que, eso, tal vez me suceda porque me encuentro en una <<aporía>>. ¿Una aporía? ¿pero qué son las aporías?

Carmen había andado desde Saint-Jean-Pied-de-Port hasta la costa de la muerte, sólo que según sus cuentas había tardado, en poder dar por terminada esa etapa de su vida, casi cinco años. Cinco años menos un mes. Y tampoco se sentía demasiado segura de que ese fuera su final porque, entonces, ¿qué hacía ahí, sentada en ese vagón, a mi lado? Para ella el Camino había comenzado en la parte española, en Roncesvalles, porque en ese momento de su existencia confesaba no haberse sentido con las fuerzas necesarias para atravesar el coll de Lepoeder… Así que se echó a caminar y comenzó a correr demasiado pero demasiado que era el miedo que dijo que había experimentado de ir a poder perderse. Así que corriendo pero porque otros corrían y, luego, corriendo a los pocos kilómetros para perder de vista a éste y aquellos con los que se veía obligada a hablar de lo que todavía no sabía, porque cómo ir a poder defender la espiritualidad, a tan sólo seis kilómetros del principio. Y, luego, descubrir que quería y no quería establecer relaciones. Relaciones porque ayudaban a seguir adelante pero no relaciones porque impedían detenerse en los momentos más felices. Y dormir con otros, con cientos de otros, noche tras noche. Y reconocer que el ser humano es cruel, a partes iguales, y que es solidario y amistoso. Y echar de menos la vera del Arga antes siquiera de dejarla, y por eso comprender, desde el primer instante del primer día, que se necesitaría regresar porque algo que se esperaba de las cosas, y que allí lo estaba esperando a uno… no se había sabido reconocer. Y Navarra qué verde era, y los otros que no entendían que Carmen pudiera exclamar cada dos minutos ¡qué bonito! Cuando Navarra no podía ser tan distinta de Asturias.

El tren, emocionándonos, por fin se puso en marcha y tardaríamos algo más de una hora en alcanzar la capital de la Baja Navarra, que en euskera se llama Donibane Garazi.

Has oído hablar -le pregunté- de esa guía medieval que escribió un monje de Poitou. El nombre del monje era Aymeric Picaud, que recordé, cuando ella luego lo pronunció, haberle escuchado al librero de La Rue en Pente, que fue quien me había hablado de él. Pero Carmen me explica que eso es lo que se creyó durante mucho tiempo porque en el ‘Codex Calixtinus’ se le menciona pero que, hoy, la redacción del ‘Iter pro peregrinis ad Compostelam’ que forma parte del ‘Liber Sancti Iacobi’, una compilación de varios escritos de la primera mitad del siglo XII y que obedece -consideran- a una idea que tuvo Diego Gelmírez y que fue redactada en diversas épocas de forma independiente, se debe a un monje de Vézelay, que también redactó la ‘Crónica de Vézelay’. Y el ‘Codex Calixtinus’ el manuscrito más importante gestado de esta compilación, el máximo representante y el que se guarda en el archivo de la catedral de Compostela, aunque también existen otras versiones completas, como la que se conserva en la Biblioteca Apostólica Vaticana, en la Nacional, y en la Biblioteca Universitaria de Salamanca, y también en la British Library de Londres, si bien la estructura no es la misma en todas; y otras versiones parciales, como el ‘Manuscrito de Ripoll’. Pero el Codex, y sus cuatro diferentes ”scriptores”, había caído en el olvido en el siglo XVII, hasta que en la segunda mitad del siglo XIX es redescubierto por el canónigo archivero pero conocido por todos gracias a la intervención de dos arqueólogos e historiadores, Fidel Fita, que era un burgués catalán que había cursado estudios de gramática y se había iniciado con los jesuitas, y Aureliano Fernández Guerra, cuyo padre era catedrático en la universidad de Córdoba, de lógica, metafísica, retórica y bellas artes, que lo describirán en un libro titulado ‘Recuerdos de un viaje a Santiago’, concentrándose, a partir del capítulo X, en un estudio pormenorizado de la obra.

Y tú tienes una memoria prodigiosa, me parece a mí.

No, no -me repite. Sólo es que me lo has preguntado y lo estoy consultando en este mismo minuto -me explica.

Pero consultando contigo misma -insisto.

– No exactamente como te lo parece.

¿Y qué más sabes del Codex?

Sé que contiene 225 folios de pergamino pero que no es el libro cerrado que nos muestra la figura del apóstol en Santiago, porque ese libro cerrado es el jeroglífico de la materia de la <<Obra>>, el que los sabios han llamado <<Liber>>, porque su textura cristalina y laminosa, como explica la gnosis, está formada por hojas superpuestas como las páginas de un libro; la materia de la obra transmutada y susceptible de manifestarse el espíritu que la contiene.

Impresionante, continúa.

¿Y por qué no continúas tú?

¿Qué quieres decir?

Quiero decir que si yo así lo quisiera tú podrías hacerlo.

Bromeas, ¿verdad?

– Por supuesto. Verás, la estructura de la obra es la siguiente. Hay lo primero una carta del papa Calixto II, a quien se le atribuye. Y hay luego un libro I, que es una antología litúrgica y que ocupa casi la mitad del volumen total del libro, con 17 sermones para las fiestas de Santiago, 2 relatos de martirio, 20 oficios, 2 misas y otra misa más e instrucciones para las de todo julio; y aún otra misa pero debes imaginarte las notas de sus composiciones musicales y también las delicadas miniaturas porque, entonces, los libros tenían un gran valor…

Podría jurar que, en todo el trayecto, Carmen no apartó sus ojos de mí, porque no recuerdo ni una sola imagen del paisaje y ni siquiera si nos detuvimos en alguna ocasión, que es bastante probable que fuera así pero cuando nos bajamos del tren, en la estación de Saint-Sean-Pied-de-Port, tenía la extraña sensación de saberlo todo acerca de todo y no sólo todo acerca del ‘Codex Calixtinus’. Echamos a andar tras el grupo de los peregrinos y algunos pasos después dejábamos el primer crucero de piedra atrás y los Pirineos nos saludaban; pasamos por delante de la poste, alcanzamos las murallas de la ciudad y, en seguida, nos asomábamos a la rue de la Citadelle, que todos empinaron y que fue donde ella me dijo que ahí nos separábamos, porque el refugio al que ella se dirigía estaba en el otro sentido. Espera, voy contigo -le digo. Pero cuando alcanzamos la iglesia de Notre-Dame tengo que pedirle que me conceda un minuto, porque quiero agradecerle a Dios que nos haya reunido.

La iglesia es exquisita, con bóvedas y vidrieras apuntadas y, en esa penumbra silenciosa, dejo volar mi renovada gratitud hacia el Creador. ¿Será cierto que en este Camino se encuentra Dios con todos nosotros? -le pregunto cuando la tengo otra vez a mi lado en la calle. Pero ella ya no me mira y sus ojos se ocultan de mí con desconfianza. A cambio nos detenemos delante de la puerta de Notre-Dame, que es la puerta mejor conservada de las que dan acceso a Saint-Jean-Pied-de-Port y que aún lleva las huellas de sus pesados batientes de clavos, que es por la que se accede al barrio de España, la ciudad nueva medieval, que en los siglos XVII y XVIII pronto se desarrolló fuera de las murallas. Paso abovedado, con bancos a los lados donde los antiguos peregrinos descansaban en espera paciente a que el hospital abriera sus puertas. Una vez atravesado el puente Eyheraberry, puente que recuerda a un puente romano pero que no lo es porque éste sobre la Nive fue construido en piedra pero en la primera mitad del siglo XVIII, la rue d’Espagne era, entonces, un opulento barrio de comerciantes y artesanos, en el que los tenderetes de los zapateros, los tejedores, los joyeros y los maestros chocolateros, atraían a los transeúntes de todo el país de Cize. Época en la que la ciudadela abrigaba una guarnición de más de 500 hombres, y este primer refugio nuestro, Le Chemin vers l’Etoile, justo se situaba al lado de uno de esos artesanos, L’Atelier du Chocolat, en el número 21, en un edificio del último cuarto del siglo XVI, y <<Mira -me dijo ella- aquí está eso por lo que me preguntabas.>>

El largo pasillo estaba muy débilmente iluminado pero una costa coronada en un montículo sobre el que se dibujaba un misterioso faro, entre un promontorio de tierra verde y magnético, en la que finalizaba un camino, y un difuminado azul pastel simulando un cielo vertical y una honda balsa de agua, le servía a Carmen para indicarme que no sólo era necesario que llegara hasta ahí, el fin del mundo conocido por el mundo clásico, sino que me desplazara, también, algunos kilómetros hacia el Norte, por la costa, otra jornada, para dirigirme a un lugar que se llamaba Muxía, y que debía ser mi auténtica meta, aunque mi guía ni tan siquiera me hablara de ello. Y, ahí, un punto desconocido en el que me estaría esperando un arcano secreto, la experiencia más mágica con la que alguna vez se pueda soñar…

Y hasta aquí te habrá traído la rúa das Hortas – que Carmen recorre con el dedo por la pared, por la que te habrás alejado del parador de los Reis que te espera en la praza do Obradoiro. Pero, antes, has de saber que, en la época en la que la guía del Codex se redactó, la entrada a la catedral de Compostela la realizaban los peregrinos por la praza do Paraíso, la puerta septentrional, Francígena o Norte del transepto, que hoy es neoclásica y no románica como en aquel entonces; porque entre los siglos XVII y XVIII la catedral experimentará esta gran transformación a la que se la va a someter hasta convertirla en ejemplo de culto a la soberbia y a la ostentación mayor; y lo que podrás admirar en la portada Sur, o de Platerías, son, en parte, algunos de los elementos que antes decoraban la portada Norte, como puedan ser la creación de Adán, o la mujer del león o la más fascinante que sostiene entre sus piernas abiertas una calavera; y en la que muchos, hasta hoy, han querido reconocer a la Magdalena, como la figura de la pecadora condenada a besar el cuerpo putrefacto de su amante pero que son, explícitamente, motivos alquímicos simbolizando las fases…

Estamos, ahora, muy cerca uno del otro, nuestros brazos permanecen en contacto y yo experimento el mismo calor que ella experimenta.

¿Qué te sucede? -me pregunta.

He visto una estrella fugaz en mi mente.

¿Y has podido pedir un deseo?

Sí, he deseado que este pasillo sea interminable pero le digo que no, le digo que eso ha sido algo tan insospechado como si fuera cualquier estrella fugaz que atravesara nuestro espacio aéreo. Y ella ha sonreído, ha alejado el dedo del círculo con el número 761, que se correspondía con Santiago, y lo ha conducido hasta Arzúa…

La casa era algo tenebrosa, de calidez un útero desnudo. Penetramos en el hueco principal y la escalera da dos vueltas cuadradas en el sentido contrario al de las manecillas de un reloj. Aquí tres mesas de madera y algunas sillas, pocas, y un sofá, sobre el que sobresale de la pared un mapa de Europa, de la Europa de los caminos a Santiago en el que Carmen aprovecha para señalarme Ostabat, del que nos separan apenas veinte kilómetros, y punto en el que confluyen las tres vías principales.

La vía turonensis o de Tours, por el célebre San Martín de Tours, que recoge el flujo del norte y noreste de Europa, y cuyo origen se localiza en la Torre de Santiago en París.

La vía lemovicensis, que pasa por Limoges,y comienza en Vézelay. Y la podiensis, o también gebennensis, que parte de Le-Puy-en-Velay, y por la que ingresan los peregrinos provenientes de Alemania y Suiza, y por la que transitó el primero de los peregrinos conocidos europeos, el obispo Gotescalco, entre los años 950 y 951. Hecho que conoceremos gracias a que hizo un alto en Albeda de Iregua, en los confines de Logroño, en el cenobio de San Martín, para encargar una copia de un libro sobre la perpetua virginidad de María Santísima, y que el monje Gomesano, se cree que su scriptor, cumplió. Y un siglo más tarde, entre 250.000 y medio millón de peregrinos por año, le emulaban. Así era el cariz, de multitudinario por aquel entonces, de la peregrinación al sepulcro del Santo. Y eso, y desde Toulouse a Eunate… parecía ser todo lo que ella podía compartirme, preguntándome, luego, si no quería mejor, yo, buscarme algún otro refugio, de entre los muchos que existen en Saint-Jean-Pied-de-Port, para pernoctar; puesto que mis reacciones no estaban siendo de agrado pero en ese instante, en que le habría expresado con gusto que nos fuéramos de allí los dos, se presentó Eric Viotte y como es un hombre tan amable, o porque yo mismo habría sentido vergüenza si él hubiera podido entenderlo, me callé.

El precio de la habitación era razonable, quince euros por dormir y por el desayuno pero esto se desease desayunar en el refugio mismo o no. Es decir, o sí o sí. Sólo que luego no habrá ninguna habitación escaleras arriba donde, tras el rellano, en la estancia con espejo pero tan oscura, se puede elegir el catre que se quiera, vaciando todo el contenido de la mochila para extender el saco, que es el gesto de la propiedad de un hueco en el camino.

Viotte nos reclamó las credenciales para sellarlas, que son los pasaportes materiales de la peregrinación; sólo que yo eso todavía tenía que conseguirlo, aunque mi compañera, que conocía el protocolo, me sugirió, mientras le tendía la suya, una con aspecto de haber sido muy usada, que le explicara que lo remediaríamos a primera hora de la tarde y me pidió que, por favor, le preguntase si se había recibido, en los últimos días o semanas, algún correo para ella, y aunque Viotte daba la impresión de no recordarla…

Asperges de Navarra en vinagreta con aceite de oliva de la Rioja y Agneau Txilindron confitado en una menestra con pimientos y maíz ecológico, es lo que vamos a comer los dos escoltados por las murallas de la ciudad, en el jardín del patio del restaurante Iratze Ostatua, en el número 11 de la rue de la Citadelle. Y eso regado con un irouléguy; un Hari Gorri Domaine de la cosecha del 2010, carnoso, tánico y agradable, con una buena nota mineral, de 203 francos, al que yo invito y que es un vino de de la zona de Saint-Jean-Pied-de-Port, y de las 15 aldeas próximas, elaborado con cepas de franc y sauvignon, en viñas plantadas en pequeñas parcelas de las laderas bajas y expuestas de las empinadas y abruptas montañas.

La comida del menú vasco aquí tiene un precio fijo, 25 euros, 164 francos pero había que decidirse pronto porque la peregrina dijo que si nos entreteníamos en dar la vuelta a todo el pueblo, para reconocer los otros menús que se ofrecían, y luego queríamos regresar aquí, ya sería tarde. Porque en su experiencia anterior así lo había sido pero yo todavía no me explico porque ella reaccionó de esa manera a la pregunta de Viotte. Porque cómo pretende que entienda lo que pueda haber de malo en reunirse con los otros peregrinos para cenar todos juntos…

Viotte nos había mostrado el resto de la casa, un retrete y una ducha, cocina-alacena y comedor de bohemio, donde algún cuadro sin vocación de obra de arte se estaba pintando, y una guitarra se apoyaba costumbrista en la pared y, entonces, ¿os apuntáis a cenar con el resto? <<¿Qué resto?>> – pregunté pero ella dijo <<Yo no.>>

¿Tú no?
No, yo no.
-Y eso por qué. Yo sí, claro que sí. Para eso estoy aquí.

¡Oh, Mon Dieu! -exclamé por dentro. Porque ella me heló la sangre con su mirada, y fue ahí cuando lo descubrí, qué significaba la asombrosa coincidencia de la estación:

<<Ils vont se voler/ Ils vont se voler/ Dans le plume/ Pour un oui/ Pour un non/ Pourquoi se battent-ils/ Au bord de un chemin>>

La letra de la canción habla del momento en que las sombras se alargan y la peregrina no aparta los ojos del plato. Los espárragos están muy sabrosos pero tampoco como para no quitarles ojo. ¿Me dejas que te hable de Vera? -le pregunto. Y ahí he conseguido que ella me mire otra vez con intensidad. A Vera se le ocurrió la noche de su cumpleaños, cuando yo insistí en que nos tomáramos otra botella de champagne mientras bailábamos en el salón pegajoso por el calor de la noche, ‘Blues in Thirds,’ y recordábamos cumpleaños que eran algo más que esta ceremonia cadenciosa y recurrente, un juego, probar, al menos, si merecía la pena… Así que nos sentamos en el sofá, bastante indiferentes ante las ofertas que nos habían ido llegando de las agencias que nos ofrecían un viaje, otro viaje más para ese verano, del que todo prometía que nos volveríamos a casa con la misma ironía con la que habíamos ido regresando de otros viajes, otros años, otros cumpleaños… A causa de esa simbiosis mental en la que uno sabe tanto del otro que acaba por terminar todas sus frases. Pero nos excitó planearlo, y acabamos haciendo el amor, como en todos sus cumpleaños pero consumidos por la fiebre de lo distinto, alegres ante la expectativa de ir a comportarnos como dos desconocidos, llegar como desconocidos al hotel y dejar que el azar nos presentara, en el comedor, en la playa; tratarse cortésmente, distraerse con gente cada uno por su lado, favorecer el azar de los encuentros y, de vez en cuando, a escondidas, vernos a solas.

Ese cumpleaños último había terminado por ser verdaderamente especial y nos demoramos en un lento desnudarnos, planificando hasta los detalles más inverosímiles, comiéndonos a murmullos cómplices, entre gemidos de deshonestidad. Y por la mañana lo decidimos en serio, y estipulamos hasta cada fase de nuestra aventura. El avión de regreso, como ya no importaba lo que pensaran los otros, lo tomaríamos juntos pero nos prometimos que nunca habría censuras ni reproches, y que dejaríamos que el libre albedrío nos arrastrara allá por donde soplaran sus vientos… Los aviones para Nairobi salían los jueves y los sábados pero antes, por si las moscas, comimos salmón y recitamos brindis y nos intercambiamos talismanes… Y ella me dijo que fue estupendo, llegar a Mombasa y tras una hora de taxi ser llevada al Trade Winds y verse sobre un bungalow en la playa, donde los monos equilibristas giraban en torno a los cocoteros y caras negras de blancas hileras de dientes sonrientes se desprendían en amable hospitalidad.

Yo llegué al día siguiente y me alojé en el hotel, a la noche la vi caminando del brazo de otro hombre y eso me impulsó a entablar conversación con Anne… Fueron casi quince días los días de encuentros furtivos con Vera y no nos escondíamos nada, de lo que sucedía entre nosotros y los otros… Pero, al regreso, yo ya no era el mismo y ella tampoco. Y ese es el motivo por el que ahora me encuentro aquí, frente a ti… Era difícil saber lo que Carmen estaba pensando pero tuve la sensación de que no había reconocido el viejo cuento de Cortázar; yo lo había recordado en Biarritz, y fue eso lo que me hizo escoger ese hotel de Les Alizés, en el número 13 de rue du Port Vieux, en el que el taxi me recogió por la mañana.

Los dos habíamos concluido nuestros espárragos y nos trajeron el cordero, ella me dio un consejo entonces. Me dijo: <<Sólo olvídate de esa historia. Y no hagas como yo, no se la vayas contando a todos porque ese tipo de historias, en el Camino, no le importan a nadie. Muchos mienten, yo también lo hice. Creo que es por la confusión. Pero dicen los cabalistas del judaísmo que la espiritualidad sólo se puede conseguir cuando uno se desespera de su vida, se experimenta desilusionado y no ve como llenarse, se siente plenamente vacío y se pregunta cuál es el sentido de la vida: ”Nada tengo ni veo y no puedo soportar vivir así”. Y de esta frustración y vacío se llega a la sabiduría de la cábala. Porque ese método es la fuente por la que se puede llenar. Es un proceso que a uno le lleva a alcanzar un alma con la que abrazar la vida eterna y perfecta. Y todos los otros métodos, incluidos los de meditación de Oriente, no tienen nada que ver con la cábala de la espiritualidad. El punto del corazón tiene que despertar en uno y eso le atrae hacia la fuente donde el ser puede realizar el método, dónde recibir, cómo yo puedo estudiarlo, cómo puedo llegar a llenar mi vasija futura…>>

¡Oh là là! ¿Hablas en serio?
– Yo no. ¿Y tú? ¿hablabas en serio?

Mi silencio es vergonzoso y lo único que hago es pedirle que continúe por donde quiera pero que no se detenga, que me gustaría seguir escuchándola…

El cabalista piensa que los demonios son algo así como los ”sparring” de tu alma pero para eso tienes que imaginarte la visión que ellos te pintan. Por ejemplo esa, que fue la que yo le escuché a uno de ellos, que eres un joven boxeador y que te diriges a un gimnasio para fortalecerte y fortalecer tus capacidades físicas… Pues en el terreno de lo espiritual sucede lo mismo, la <<kabbalah>> puede justificar la existencia de las dificultades y de los demonios sólo por el hecho de que el alma que recibes, y en esto hay disparidad de criterios… viene aquí a fortalecerse, porque presenta debilidades. A pesar de ser parte constitutiva de la misericordia en estado puro, de la dulzura en estado puro, que Elohim o Eloha, porque Elohim es plural, se arrancó de sí para hacértela llegar a ti, que eres el iniciado, desde Keter o primera esfera del árbol de la vida, el Aleph, que habitas Malkut, y que si estás circuncidado eres la desposada de Dios. Así que si mientes, mientes porque tu alma carece de la fuerza para decir la verdad, y el demonio estará ahí esperándote, para que te golpees contra él, y puedas salir victorioso, y tu alma fortalecida, de ese combate. Pero si no estás circuncidado, ni has experimentado la conversión que jugará el papel de líquido amniótico y por el que simbólicamente nacerás de madre judía… las herramientas que Dios te ofrece, las letras sagradas de su alfabeto, con las que pescar sus bendiciones y dirigir tu destino hacia la felicidad, tomando el control de tu vida, por encima del fatalismo planetario y el caos existente… te será imposible. Y sólo experimentarás el rigor y la severidad del reino de la tierra. Pero si esto no te desanima, te puedo dar una muestra de humor judío, a ver que te parece:

Sabes, Abraham, la vida es como un vaso de té.

– Pero David, ¿cómo un vaso de té? ¿por qué?

Y yo que sé, Abraham. ¿Acaso soy filósofo?

 

Hay un psicoanalista hispano-argentino, José Slimobich, que es quien esto nos lo contaba, que afirma que el humor es el vuelco inesperado donde nuestra ignorancia y ácida visión del otro se convierte en gracia, permitiendo un giro efectivo, pues al escuchar un chiste o encontrar en nosotros mismos algo de humor, el mundo se vuelve más liviano. Pero si el asunto del esoterismo judaico te interesa en realidad… puedo facilitarte la dirección de un rabino en Pamplona, un cabalista de prestigio que se mostrará conforme de recibirte si le confirmas que le visitas porque, como peregrino de la ruta, te lo ha pedido Mme. Blanchefort. Dime Hervé, me equivoco o no es el humor, por encima de todo, lo que tú prefieres, lo más liviano de la vida…

No, no te equivocas mucho pero no es el humor sólo lo que enriquece mis días. De hecho esto que estamos comiendo preferiría haberlo cocinado yo para ti, y por eso me extrañó que no aceptaras cenar con nosotros en el albergue, porque me gustaría conocer tu opinión, acerca de cómo domino la que es una de mis mayores pasiones, la cuisine impromptue, que para mí es una forma de arte. Et aussi, j’adore la musique et mon chanteur préféré c’est Renaud Sechan. Vous le connaisez? ¿Pudiste comprender lo que te dije?

Un poco pero creo que me gusta igual escucharte hablar en francés.

Bon! Pues ahora mismo te doy una conferencia en francés sobre los cómicos franceses, ¿qué te parece?

Que me parece mejor en español. ¿Tu cordero esta bueno?

Excelente. Igual que el tuyo, espero. ¿Está bueno?

Sí, lo está. Está muy bueno.

Y no quieres cambiar de idea y ¿reunirte con nosotros para cenar?

No, no, eso no

D’acord.

Pero, luego ella prosiguió con Slimovich y aquello acerca del hundimiento del Titanic y, después, con lo de la mujer que le recrimina a su marido que jamás le haya comprado ni un vestido ni una falda o abrigo… ¿Y qué le responde el marido? ¿algo muy distinto a lo que le responde el compañero de David, al David que ve hundirse al Titanic? No: <<No sabía que vendías ropa.>>

Y, a partir de ahí, nos hemos enredado en el entramado de la comedia francesa y yo he comenzado a hablarle de Le Splendid, que se localiza en el distrito cuarto, en la calle de los Lombardos y que le recomiendo visitar si es que va a París. Y, sin pretenderlo, nos hemos puesto a debatir sobre las películas de Josian Balasko, una mujer muy polifacética y talentosa que, por cierto – digo ironizando-, bromea en sus películas : ‘Ma vie est un enfer’ y ‘L’ex-femme de ma vie’, con el psicoanálisis de tu amigo Slimobich, y que será cuando ella va a responder con igual intención: <<¿Cómo vera?>>

No, Vera y yo no estamos separados. Y esta mujer -prosigo, lo primero, refiriéndome a Josian- además está muy unida a Enfoirés, que es una asociación caritativa que fundó otro cómico muy querido por nosotros, Coluche. Y después, y en un intento de eludir la inevitable -porque lo presentía- confrontación, por… pero qué es lo que ella dirá, entonces:

Yo de Renard sólo conozco una frase, que fue, por otro lado, lo que también me sucedió con Schopenhauer en su momento: <<El más largo aprendizaje de todas las artes es aprender a ver.>> De Prévert un poema, ‘Barbara’, y un guión en el que colaboró, el de <<Le quai des brumes>>, que conserva el beso más sonado de la historia del cine francés. Y de Queneau, el frío que dejó de existir para Lehameau cuando las hojas de sílex se hicieron polvo bajo sus pies y la condenada idea de hacerse pasar por una adolescente irlandesa, que quería aprender a escribir como James Joyce.

¿Y cuál era la cita de Schopenhauer?

<<Ningún viento es favorable para aquel que no sabe a qué puerto se dirige.>> Ni siquiera los alisios. Pero también sé que esto que les sucedía a vuestros cómicos le ocurría a la Gréco con Queneau, cuando Sartre le mostró sus poemas y ella, que era la musa del existencialismo, comenzó a cantar… ¡Ah no! Que no te extrañe, lo sé circunstancialmente porque estoy manuscribiendo unos ensayos sobre el arte de la novela, y también sé cosas como que yo para ti sólo podría ser una dejantée como Brigitte Fontaine, una pirada y la musa de la vanguardia, que a los 17 años debutó en el teatro con una de esas cimas del absurdo, ‘La cantante calva’ de Eugène Ionesco. Y porque había nacido el mismo año en que Nathalie Sarraute publicó sus ‘Tropismos’, 1939, que pasaron desapercibidos a causa de la Segunda Guerra Mundial, y de los que Vargas Llosa no conserva buena opinión, y que es quien dice que en la civilización del espectáculo el cómico es el rey… Sin embargo, Llosa, admira a Sarraute en su ensayo, ‘La era del recelo’, que publicó Gallimard en 1956, aunque él, a diferencia de otros, traduce <<soupçon>> como sospecha, y por eso me interesaría saber cómo lo traducirías tú.

¿Cuál era el nombre de ese rabino de Pamplona?

El rabbi Abu-Joseph Aben-Hasdai.

¿Y cuál es su dirección?

Eso ahora no puedo decírtelo.

¿Me acompañarás tú a verlo?

Tal vez… El poema y el chiste son dos mundos que se tocan en algún punto y nos muestran la ruptura con el tiempo, un imprevisto, algo que no esperábamos y ha sucedido por obra y gracia del lenguaje -como dice Slimobich. Una rebelión, el espíritu de la ambigüedad…

 

<<Elle a mis sur le mur… / Une photo d’Arthur Rimbaud… / Sur le papier peint/ Je trouvais ça étrange/ Je ne dis rien/ Elle me font marrer/ Ses idées loufoques>>

 

En Saint-Jean-Pied-de-Port son múltiples las puertas medievales, que atravesamos como seres fatigados de nuestra época. Esta ojiva, en concreto, por la que nosotros vamos a aparecer frente al Hôtel de Ville, la mairie, que se encuentra a la vista de la Oficina de Turismo, es la puerta de Navarra o del Mercado. Pero ahí mismo nos dicen que hemos de imaginárnosla entre el ruido y la afluencia de las manufacturas y el comercio de lana, los cerdos y el jamón, los productos de los pastores, y los cereales y el vino, los almadreñeros, algunos de este lado, otros del lado de la sierpe pero toda persona que entraba en Saint-Jean-Pied-de-Port tenía que abonar un derecho de paso, y para eso estaba el recaudador de impuestos, encargado por el rey de cobrar los peajes y las tasas sobre las mercancías vendidas en este opulento mercado medieval que también atraía a los peregrinos que hacían aquí noche.

Canteras de gres rosa y dinteles que conservan las huellas de los diferentes gremios, tejedores, sastres, sombrereros, cerrajeros o barberos. Nosotros vamos a sentarnos en el café Tippia, un bar-brasserie, con terraza, sobre la Nive y bajo arces, a orillas de la cual, por aquel entonces, se situaban las curtidoras.

Yo le hablo de mi trabajo como profesor, del regalo que ha supuesto para mí esa vida, metódica, lúcida, tranquila, hasta que se atravesó en ella Véronique con su mofa constante. Por lo demás es el trabajo en el que siempre he pensado que me gustaría jubilarme. Comencé estudiando economía pero el primer año descubrí que ese mundo no me satisfacía y tomé la decisión de matricularme en la Université Paris 8, en el área de letras y lenguas, en Saint-Denis, hecho del que nunca me habré de arrepentir.

 

<<Durante toda mi vida he tenido la impresión de estar aquí y lejos>>, algo que la peregrina expresa y que yo también recuerdo, porque cita a Kieslovski, en ‘La doble vida de Verónica’; una historia basada en el mito del <<doppelgänger>>, aquel cuya existencia resulta fatídica de conocer, y que ella sugiere que surge de una experiencia anterior del propio director, como un personaje secundario que asomaba en forma germinal en el episodio noveno de su ‘Decálogo’, como una joven que habría de sufrir una delicada operación para seguir cantando: azar, necesidad, casualidad, teoría de, la predestinación, vidas cruzadas, encuentros y desencuentros. Y Carmen lo que se confiesa es enamorada del Philippe Volter, Alexandre Fabbri en la ficción, que maneja de forma magistral los hilos de sus marionetas… y del papel que juega en esa historia el espejo, la sensibilidad y el presentimiento.

– Ça va?

– Ça va bien.

Dejamos el café y desandamos lo andado hasta la rue de la Citadelle, porque como ella me recordaba había que solucionar lo de esa credencial. La actriz Shirley McLaine se convirtió en una de mis actrices preferidas desde que la conocí en Irma la Dulce, y ella habla, en su viaje espiritual, de las ”líneas ley”, a través de las cuales la Tierra irradia la extraordinaria energía que fluye a través del subsuelo. Esta energía emana a una frecuencia muy alta y la actriz explica que cuando es experimentada por una consciencia humana, induce claridad de pensamiento, memoria y revelación.

Carmen y yo nos encontramos frente a la Maison Laborde y ahora soy yo el que guardo silencio. Estamos a un paso de deslizarnos dentro cuando -aparentemente- echo a faltar mi teléfono: ¡Oh! -le digo poniendo mi mano derecha sobre su brazo para detenerla. ¿Te importa acercarte tú al café y yo lo haré con el restaurante, luego? Ella dice que de ninguna manera le importa, y que o nos encontramos en el albergue o a medio camino pero me pide que, mientras, le guarde esa bandolera de la que no se separa. Así que me la tiende sujetándola con el dedo pero cuando voy a agarrarla casi me voy con ella de bruces al suelo. Pero, ¿qué llevas aquí dentro? -le pregunto- ¿una losa? Carmen se echa a reír y me responde: todavía te puedo contar otro chiste de judíos. Estos son un musulmán, un cristiano y un judío, a los que les ha caído un dinero del cielo. Entonces, el musulmán mira a sus otros compañeros y dice: <<Esto me lo ha dado Alá y a Alá tengo que devolvérselo.>> Y lanza el dinero al cielo pero el dinero cae otra vez a la tierra porque la fuerza de la gravedad existe y es lo que comprueban, y aunque lo que decide el musulmán es que se lo entregará al imán de su mezquita, que es su intermediario con Dios. Luego, el cristiano hace la prueba, y cuando el dinero cae, lo que piensa es que debe entregárselo a la beneficencia. Pero, ¿y qué será lo que ocurre cuando eso le sucede al judío? El judío qué dice Slimobich que dice: <<Dios tomó lo que quiso y lo que no quiso seguro que quiere que sea para mí.>>Ya sabes: <<La gracia malvada del espíritu libre.>> (Lacan). Pero ya nada me parece divertido y pienso en Véronique y ese odio del católico del que ella se burla, y lo que me explica Janine Curutchet es que primero fue Mme. Debrill, de la que ella era ama de llaves, quien manejaba la recepción de peregrinos en el número 27 de esta misma calle. Una mujer encantadora, que a pesar de su avanzada edad no ha perdido ni un ápice de su talante jovial. Estoy de suerte porque me asegura que me la he encontrado sola por un casual y me pide que, si no tengo inconveniente, rellene yo mismo el formulario de mi credencial. Al principio ella ha pensado que voy a quedarme en el albergue municipal, y se queja un poco de que las personas que la frecuentamos cada día nos estemos volviendo más y más exigentes, aunque reconoce que a ella le agrada acogernos y me ofrece un té que no puedo rechazar. Luego, es cuando he comenzado a escuchar una música que se escapa de la bandolera de Carmen, y he pensado que era una rotunda estupidez cargar el peso de un portátil como ese por el Camino. Mi teléfono ella no lo habrá encontrado porque se quedó en Le Havre, esperando sobre una nota en la que me despedía de Albany y le pedía que no hiciera nada por buscarme. Todo estaba acabado ya entre nosotros y ella, con su conducta imperdonable, había dictado la última palabra. Pero esa música no dejaba de sonar y, a cada segundo que transcurría lo hacía cada vez más fuerte, hasta el punto de resultar ensordecedora y aunque Mme. Curutchet ni tan siquiera parecía percatarse. Era la barcarola de ‘Los cuentos de Hoffmann’, también conocida como ‘Belle nuit’ o ‘Nuit d’amour’, y la apabullante imagen de la belleza de Anna Netrebko se me mostraba con claridad desde las páginas de Vogue… pero luego la imagen se transformó y le llovieron algunos años y muchos kilos de más encima, y experimenté una repugnancia desconocida, porque me sentí incomprensiblemente traicionado por esa mujer, y que fue cuando la música, despiadada, se detuvo.

Advertí a Albany, en la biblioteca, en aquella semana en que la Escuela comenzaba a practicar un intercambio experimental, y abracé la ilusión de que si los ángeles del paraíso existen debían de asemejarse a ella.

Albany se movía por entre la inexistente sección de filosofía extranjera y de pronto tomó un libro entre las manos y, ensimismada, se quedó ahí de pie leyéndolo. El libro pertenecía a un filósofo alemán y ella, sutilmente, dobló las dos hojas en que – imaginé- intuía descubrir sus respuestas. Pero, justo en ese justo segundo, la alarma de incendios se disparó y aunque nadie comprendió luego porqué. Yo me precipité sobre el libro para conocer qué era lo que tanto podía haberle llamado a ella la atención, necesitando de varios días y de un diccionario para descubrirlo. Fue algo que no se repitió nunca y todavía, después de tantos años, no he olvidado. Pero esta mañana, el texto, estaba fresco en mi cabeza como un vaso de leche tibia, recién salida de las ubres de una vaca.

Albany estuvo a punto de llamarse Dana por James Dwight Dana, porque su padre, que es astrónomo, también era un gran aficionado a la vulcanología, y Dana había nacido en Utica como ellos, en el condado de Oneida, en el estado de Nueva York. Pero ese mismo día, en el que la madre de Albany le comunicó la buena nueva del embarazo, ambos salieron a la calle muy felices a celebrarlo, porque Dana iba a ser una hija tardía y muy esperada y, entonces, él vio ese cuento de Gregory Maguire, en la librería católica de Utica, ‘The lightning time’, que había nacido en Albany, también un condado del estado de Nueva York y que se graduó en literatura inglesa y americana, y esa misma tarde empezó a leérselo al interior del vientre de su madre. Así que cuando poco después coincidió que la IAU, la Unión Astronómica Internacional, de entre los 500.000 cráteres de Marte, donde James Dwight Dana también tiene el suyo, Albany ocupó el lugar de los 23º N 49º W, el destino de mi dulce chica neoyorkina quedó por siempre marcado por el influjo del planeta rojo. Pero eso no fue evidente para ninguno hasta que la misión del Mars Science Laboratory, más conocido como Curiosity, se puso en marcha, y Albany decidió que en ese viaje interplanetario se expedicionara su alma. Así que se preparó para encontrarse en Cabo Cañaveral, en Florida, y para hacer frente a una travesía de 9’65 millones de kilómetros pero el lanzamiento se retrasó, desde el 8 de octubre del 2009 hasta, primero el viernes y luego, el sábado de un 26 de noviembre del 2011 y, en ese espacio de tiempo, sólo trató de contestarse a una pregunta: ¿existió vida alguna vez en Marte?

<<… and now I sit here despairing / I think of nothing else: this fate gnaws at my mind…>> -se pregunta el Cavafis que nunca llegó a escuchar el ruido, o el sonido de los constructores, que imperceptiblemente le habían encerrado fuera del mundo. Y estoy ahí detenido cuando la veo venir agitando contenta su mano. Tengo que darte una mala noticia -me dice mientras me coge del brazo y nos encaminamos hacia el portal de Saint-Jacques, que se encuentra en la parte más alta de esta pintoresca villa, donde las mujeres andan, como una costumbre, descalzas por la calle. Esa era seguro Mme. Sinanian -me confirma la peregrina. La propietaria de Au Cant du Coq, otro refugio como el de Viotte. Y no he sido inmediatamente consciente de ello pero, cuando ella se ha cogido de mi brazo, he comenzado a experimentar una levedad desconocida que he dejado de experimentar cuando nos detenemos frente a este paso previo a la ciudadela militar. Paso que en el año 1998 fue declarado por la UNESCO patrimonio cultural de la humanidad.

Una escalera lleva a la Ciudadela también por un camino de ronda pero la decisión de convertir Saint-Jean-Pied-de-Port en una ciudad de guarnición, entre Pamplona y Bayona, se tomó por ser éste un contexto de conflictos permanentes entre España y Francia. Contexto que adquiere forma a principios del siglo XVII. Las murallas fueron reforzadas y la ciudad se convirtió en un puesto militar estratégico para las tropas francesas, y de Vauvan, por encargo de Louis XIV, se llegó hasta aquí para inspeccionar la Ciudadela sugiriendo algunas modificaciones, como nuevos cuarteles, subterráneos, y una ”puerta de socorro” en el frente Este. Más adelante, la fortificación, sufrió nuevas reformas, lo que hizo que jugara un papel de primer orden en las guerras de la Revolución y en las guerras del Imperio, resistiendo incluso a un sitio. Así que a partir del siglo XVIII la vida de los ciudadanos de la villa transcurría al ritmo de los ejercicios militares pero perdió su calificación de militar en 1920. Pasando, entonces, a ser clasificada como monumento histórico en 1963 y sirviendo, en la actualidad, como colegio. Respóndeme, por favor, a una cosa que me tiene bastante preocupado, Carmen: ¿tú eres antisemita? -le digo.

¡No, claro que no! Ni yo ni Slimobich somos antisemitas. Y me alegra que me lo preguntes pero también podías haberme hecho otra pregunta: ¿qué tienen que ver los judíos con el dinero?

Me experimento, otra vez, bastante anonadado, casi no me reconozco y no comprendo qué podía haber estado pensando para indagarla de esa manera, tan desconcertante. Lo siento, tienes razón –digo a modo de disculpa- ¿qué tienen que ver los judíos con el dinero?

– Se cree que los judíos llevan en la India desde el tiempo del rey Salomón, y que a excepción de la India, en la que se les ha tratado con tolerancia, siempre han sido acosados o perseguidos. Pero hay una actitud que se desprende del judío de la diáspora, que es la actitud del asentimiento al castigo y la maldición de ser el pueblo elegido, elegido para cargar sobre sí el peso de los pecados del mundo: un pueblo de pastores, que pastoreaban sus rebaños y cultivaban como aldeanos el suelo. Un pueblo que se fue extendiendo por todo el mundo y que es el encargado de manejar el dinero porque su religión no rechaza el dinero y por eso acumula el dinero, y porque para el noble y el gentil ese manejo estaba prohibido, como era el caso de los príncipes polacos… Así que el judío presta el dinero al poderoso y, a cambio, recibe un papel en el que se le exige al campesino; por lo que representando el papel de testaferros del poder, de rostros visibles de la explotación, son los que reclaman el pago de la deuda y cuando, como en el caso de los cosacos y los tártaros, surgen las grandes sublevaciones contra los príncipes, el pueblo marcha sobre quienes reconocen como responsables del hundimiento personal de sus vidas, y es así como se comprenden los grandes <<progroms>> que hubo en la Europa oriental en los siglos XVI y XVII, porque tampoco tenían manera de defenderse y podían ser despojados de todo en todo momento. Y eso es lo que va a cambiar a raíz del Holocausto y la formación del estado de Israel, la concepción de que ofrendar la vida a Dios era un deber… pero en la memoria colectiva, donde existe el odio al semejante y el odio a la diferencia, que es -según este psicoanalista- el terror a la diferencia de lo que goza el otro, y de un sentimiento que no alcanzo a comprender, ya habrán sido marcados por su intensa relación con el dinero… y en el humor, y en la risa, con lo que nos encontramos es con que el punto de vista intelectual ha vencido a la desgracia y nos libera de la angustia. El chiste es el ahorro del despliegue afectivo.

Ya pero eso no explica porque tú eliges contar chistes sólo de judíos.

Porque son los únicos que conozco y porque los escuché en esa conferencia. Yo no veo ni la televisión ni asisto a espectáculos cómicos, y ni siquiera me relaciono con los demás desde hace años, Hervé.

 

[CAUCUGUUCGUUCUACAUACACUAUACUCCGCUACUCUAUCUUCACAUACGU]

https://elespiritudelchemin.wordpress.com/solucionario-de-cahier-ame/

Anuncios

Un comentario Agrega el tuyo

  1. ”El conocerse es en el Espíritu la existencia”

    H. W. F. Hegel

    Para quien conoce y recorre este camino… resultará relativamente sencillo situarse pero aún así va a chocarse con algunas extrañezas. Y en la segunda lectura, como es lógico, uno querría recorrer la acción de un modo lineal, consecutivo, aunque así se pierda el orden de la casualidad. Ésta que continúa es esa segunda lectura:

    El aliento de Natashia / La salida del albergue de Peñaseíta / El mágico bosque en el ascenso al Puerto de El Palo / Signos en devenir / En el Alto de El Palo la aparición de un viajero / De paso por Montefurado y de camino a Lago / Las confesiones de Robert Walser / Tras la comida, el viajero y el peregrino, se ponen en marcha / La llegada a Berducedo / La peregrina eslovaca / La estrategia del tejo / La llegada al albergue de La Mesa / El trágico accidente / Julien Green / El corazón de Dios / Creer y sentir / Las compañeras de camino / El congreso del Finnegans Wake / El discurso del placer / La pureza de la espiritualidad / El acelerador de personas / La llegada a Grandas de Salime / Los fundamentalismos cristianos / El albergue en Grandas de Salime / ¿Un milagro? / De Malévich y Baumgarten / La caja metafísica / La ayuda necesaria / Del complejo boceto / El beso de Natashia / El asesinato de la peregrina Denise Thiem / La salida de Grandas de Salime / El encuentro con C. S. Lewis, como Clive / Conociendo el amor / La fuerza del eros / La felicidad de la philia / La construcción de la amistad / El conocimiento intelectual de la caridad / La conversión de C. S. Lewis al cristianismo / El sentido del sufrimiento / La comida en A Fonsagrada / De la experiencia en la caja metafísica / Las explicaciones de Ne-Je / La molécula de la fe / El discurso del psicoanálisis según Alfredo Eidelsztein / El discurso del saber según Arturo Frydman / Los destinos celulares y el lenguaje del inconsciente /

    .

    / Atrévete a saber de la excelencia moral / El tacto infinito / Caminando con Diotima de Mantinea / La amistad para Aristóteles y Epicuro / La amistad para Cicerón y Séneca / La Durée de Bergson / Caminando con Guillermo Páramo Rocha / En el nombre de los matemáticos / El caparazón de Reichenbach / La llegada a O Cádavo / Con Alessia de Liubliana / Sin noticias de ellas / El método de C. G. Jung / La alucinación / Caminando con Adrienne von Speyr / De la aporía del instante / Hablando del odio y de Dios / El lenguaje de la palabra pura / La noche del amor perfecto / La despedida de Adrienne / Mauriac, el analista de conciencias / La llegada a Lugo / De la ciudad origen y el experimento colectivo / Los billetes de autobús / Los elohim y la oración incesante / El terremoto de Lisboa y la catedral de Lugo / Los principios del protestantismo / La verdad de Parménides / El despertar con Peter Grimmig / Sensaciones extrañas / La muchacha que andaba descalza / Las aves y las sibilas / El abandono / Los augures de Plinio / Los misterios de Santa Eulalia de Bóveda / Los galiambos de Catulo y el culto de Atis y Cibeles / La llegada a San Román de la Retorta / El homenaje de Luz Pozo Garza / La acogida de los peregrinos / La identidad de Euler / La suspensión de la credulidad / La llegada de la doctora Osip / De las virtudes del cannabidiol / Los factores anti-tumorales de los cannabinoides / Los sueños que se repiten / La inédita creación del espíritu / El método de María Zambrano / La poesía de Arseni y Andrei Tarkovski / La vida en los límites / El perro hospitalero / El destino de Robert H. Blyth / El homo viator de Gabriel Marcel / Caminando con la historia de Martín Barriuso / La justicia de Manuela Carmena / La hora de la política / Un recorrido por la historia / Caminando con Michel Onfray / La llegada a Melide / El papel de la filosofía en el mito / Las ideas revolucionarias de Manuel Castells / Comunidad, inmunidad, religión y umma / El problema del Islam / El Pulitzer de Kevin Carter / El papel del artista y la creatividad / La paz de Sájarov y el mal de Küng / El secreto de Oppenheimer / El Camino de Andoni Moreta / El lugar del psicótico / Los casos de Issei Sagawa y Altusser / Los postulados filosóficos / Lugares comunes / El Reino de Jesús / Fideísmo, deísmo, teísmo y panteísmo / El conocimiento de los cannabinoides de Manuel Guzmán Pastor / Caminando con August Strindberg / La psicosis de Swedenborg / Pasando miedo / El monumento del Monte del Gozo / La llegada a Santiago de Compostela / El comienzo del Camino / La cena en el albergue de Saint-Jean-Pied-de-Port y la partida / El viaje con la española / El final del sueño / Aparentemente sin conexión / La fisiología del sueño / La sonrisa del profeta Daniel [o parámbulo]

    Créditos de este ensayo dramatizado, Libro Tercero [o Primero] de CAHIER ÂME. Todos los que se aportan a través de estos comentarios.

    Manuel Guzmán Pastor / Clemente de Alejandría / Tomás de Aquino / Aristófanes / Aristóteles / Manuel Asensi / Marco Aurelio / Gaston Bachelard / Alain Badiou / Baudelaire / Samuel Beckett / Henri Bergson / Leon Bloy / Bollnow / Borchardt / Jorge Luis Borges / Joë Bousquet / André Bretón / Luis Buñuel / Agustín García Calvo / Giorgio Candoni / Catulo / Julio César / Cicerón / Pablo Coelho / Pablo de la Cruz / San Juan de la Cruz / Eduardo Chillida / Jacques Derrida / Emily Dickinson / John Donne / Meister Eckhart / Alfredo Eidelsztein / Paul Éluard / Epícteto / Epicuro / Esquilo / Filostrato / Otto Fisher / Quinto Horacio Flaco / Michel Foucault / Arturo Frydman / Robert Frost / Ana Goutman / Julien Green / Guardia Pons / Romano Guardini / Heidegger / Helena / Agustín de Hipona / Friedrich Hölderlin / Michel Houellebecq / Janni / Jenofonte / James Joyce / Juliano / Paul Klee / John Lennon / Levin / Henri de Lubac / Gregorio Luri / Martin Luther King / Peter Kingsley / Milan Kundera / Jacques Lacan / Laplace / Leibniz / C. S. Lewis / Locke / Ignacio de Loyola / Maurice Maeterlinck / André Malraux / Gabriel Marcel / François Mauriac / Dmitri Mendeléiev / Xurde Morán / Jean-Luc Nancy / Marie Nöel / Novalis / Teresa Oñate y Zubia / Rudolf Otto/ Guillermo Páramo Rocha / Parménides / César Pavese / Platón / Luis Pimentel / Alejandra Pizarnik / Plinio / Luz Pozo Garza / Giovanni Quessep / Ratzinger / Reichenbach / Renaud / Paul Ricoeur / Silvio Rodriguez / Enrique Rojas / Jean Jacques Rousseau / Carl Sagan / Guillemo de Saint-Thierry / Ada Salas / Singul / Salinger / Séneca / Edmund Spenser / Baruch Spinoza / Suter / Rabindranath Tagore / Tarrida del Mármol / Igor Teréntiev / Thibon / Ricardo Urueta / Vicent van Gogh / Craig Venter / Vico / Robert Walser / Simone Weil / María Zambrano / Andrei Tarkovski / Arseni Tarkovski / William James / Robert H. Blyth / Pável Florenskij / Martín Barriuso / Manuela Carmena / Jean-Jacques Rousseau / Condorcet / Michel Onfray / Antonio Piñero / Manuel Castells / Giorgio Agamben / Roberto Esposito / Vrúbel / Baars / Block / Calmet / Proudhon / Noam Chomsky / Andrej Sájarov / Hans Küng / Daniel Andréiev / La Biblia / La Bhagavad-gītā / Roosevelt / Blanchot / Althusser / Lao Tzu / Buber / Tim Robbins / Aristarain / Loisy / Erasmo / Montaigne / Ana del Valle / Cioran / W. B. Yeats / August Strindberg / Octavio Paz / Dylan Thomas / Lord Byron / René Char / Renard / Schopenhauer / Quenau / Sarraute / Ortega y Gasset / Fidel Fita / Aureliano Fernández Guerra / Bertrand Belin / José Slimobich / Mario Vargas Llosa / Mallarmé / Wittgenstein / / Carlos Paola / Silvia R. Pontevedra / Pablo García Baena / Emilio Olcina / Luis Vivanco / Abdennur Prado / José Lezama Lima / Francisco Pérez Abellán / Torcuarto Fernández Miranda / Romano Van Der Dussen / Proudhon / Gregorio Morán / Reinaldo Teixidor / Michel Onfray / Joan Garcés / Manuela Carmena / Cristina Sánchez / Guillermo Velasco / Francisco J. González Ponce / Aires Augusto Nascimento / Ricardo Alcocer Urueta / José Luis del Barco / Axel Cherniavsky / Feliciano Blázquez Carmona / Teresa Oñate y Zubia / Alister McGrath / Raúl González Salinero / Juan Pablo Martínez / Rolando Picos Bovio / Joaquín Beltrán Serra / Emilio Lledó / Antonio Malo Pé / M. Arnold / M. Nussbaum / Ángel J. Cappelletti / José María Zamora Calvo / Carlos Pereda / Thomas Robinson / Víctor Palacios Cruz / Carolina Pérez / José Manuel Cuesta Abad / Roni Akiki / Ángel Sánchez / Koldo Landaluze / Ángel M. Lorenz Rodríguez / Iván García Sala / Deborah García Bello / Juan Ramón Carbo García / Antonio Bentue / Anne Baring / Jules Cashford / Luz Pozo Garza / M. Albero / Jorge Montenegro Rúa / Emilio Aliaga Girbes / Maurice Blanchot / Gustave Thibon / Marcelo Augusto Pérez / Jacob Böhme / Victoria Cirlot / Cristóforo Gutierrez / René Uribe Ferrer / Carlos Alberto Carbajal Correa / Manuel Mandianos / Ana Goutman / Allan Hobson /

Es uno filósofo guardando silencio

Introduce tus datos o haz clic en un icono para iniciar sesión:

Logo de WordPress.com

Estás comentando usando tu cuenta de WordPress.com. Cerrar sesión / Cambiar )

Imagen de Twitter

Estás comentando usando tu cuenta de Twitter. Cerrar sesión / Cambiar )

Foto de Facebook

Estás comentando usando tu cuenta de Facebook. Cerrar sesión / Cambiar )

Google+ photo

Estás comentando usando tu cuenta de Google+. Cerrar sesión / Cambiar )

Conectando a %s